Dear readers,
Armed civilian groups that patrol the U.S.-Mexico border in search of illegal migrants are hopeful that they will be asked to officially cooperate with Donald Trump's immigration agenda. The news comes as migrant caravans continue to make their way to the United States, despite the president-elect's deportation threats.
We also spoke to former German chancellor, Angela Merkel, about her time in power, her life in the GDR and her legacy; traveled to Pervomaisk, the last Ukrainian city to host nuclear weapons; and took a deep dive into NRx, the neo-reactionary movement that believes that democracy is a mistake.
And in lighter news, we looked at Taylor Sheridan, the cowboy-turned-director behind the success of hit TV shows such as 'Yellowstone.'
We hope you enjoy this selection of stories from EL PAÍS USA Edition.
You can also read:
- Ben Feringa, Nobel Prize in Chemistry: ‘A single cell is more complex than an entire city’
- Miami Art Week 2024: The Latino artists to watch
- Journey to La Rumorosa, Mexico’s UFO town
- AI to slash music and audiovisual industry revenues by over 20% by 2028, report warns
- The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

No comments:
Post a Comment