Hello everyone! This is the blog for the C1 and C2 classes! I'll be posting some activities / videos / homework / pieces of writing and many other interesting resources. You'll be able to find some websites and other useful material. Visit it regularly, please!
Tuesday, 31 December 2024
Monday, 30 December 2024
How to Be an Alien
Yes, I know the book was not published very recently... but it could be a good read for Christmas. It's short, it's fun and you will learn about the British... Try some first pages here and if you want to carry on reading, pop into your favourite bookshop and get it.
Crossing the hell of the Darién jungle
Dear readers,
In the first 10 months of 2024, over 280,000 migrants crossed the Darién jungle, including Venezuelans, Ecuadorians, and people from countries as far afield as Vietnam, DR Congo, and Afghanistan. EL PAÍS followed a group of these travelers as they made the treacherous journey, and shared their difficult stories.
We also looked at the furor sparked by Donald Trump's demands that Panama reduce the fees for U.S. shipping crossing the Panama Canal or return its management to the United States.
Other highlights from this week include an interview with 'Squid Game' director Hwang Dong-hyuk, a feature report into Colombia's mercenary network and an infographic special into whether it's possible to manipulate the weather.
We hope you enjoy this selection of articles from EL PAÍS USA Edition
Dear readers,
In the first 10 months of 2024, over 280,000 migrants crossed the Darién jungle, including Venezuelans, Ecuadorians, and people from countries as far afield as Vietnam, DR Congo, and Afghanistan. EL PAÍS followed a group of these travelers as they made the treacherous journey, and shared their difficult stories.
We also looked at the furor sparked by Donald Trump's demands that Panama reduce the fees for U.S. shipping crossing the Panama Canal or return its management to the United States.
Other highlights from this week include an interview with 'Squid Game' director Hwang Dong-hyuk, a feature report into Colombia's mercenary network and an infographic special into whether it's possible to manipulate the weather.
We hope you enjoy this selection of articles from EL PAÍS USA Edition
You can also read:
- ‘Squid Game 2′: ‘I won’t do this again. I lost several teeth in the process’
- When your language faces extinction: A photographic exhibition highlights over 120 endangered languages in the US
- When the surgeon chooses the wrong organ: A more frequent error than previously thought
- From Platonic love to Stoic endurance: Everyday expressions we stole from Greek philosophers
- Why do we see ourselves as morally superior to other historical eras?
- Robin Dunbar: ‘A good network of friends increases your life expectancy’
Saturday, 28 December 2024
Day of the Holy Innocents
On December 28th, Spain celebrates Día de los Santos Inocentes. This holiday, similar to April Fools' Day, encourages pranks and jokes, known as inocentadas. April Fool’s Day is celebrated on 1 April in many countries around the world. On this day,
people traditionally play practical jokes on each other and have fun trying to make other
people believe things that are not true.
Do this activity to find the vocabulary used on this day:
When you've finished, find the answers here.
Friday, 27 December 2024
Thursday, 26 December 2024
Tuesday, 24 December 2024
Monday, 23 December 2024
A Christmas Read
A Christmas Carol By Charles Dickens [By courtesy of AAEOICT (Asociación de Amigos y Alumnos de la EOI de Cartagena)]
11 keys to the Gisèle Pélicot case
Dear readers,
Dominique Pélicot and 50 other men have been found guilty in what is perhaps one of the most high-profile, shocking, and globalized trials of the last decade. We go over the keys to a case that leaves nobody indifferent.
This week we also bring you a one-on-one interview with Marine Le Pen, the leader of France's far-right National Rally, as she faces a make-or-break moment that could soon lead her to the Élysée, or to prison.
EL PAÍS also interviewed the American philosopher Judith Butler and the actor Jude Law. Other featured stories this week include an analysis of the group leading change in Syria, a look at Madrileños who can't afford rent and live in capsules, and a look back at Playgirl magazine's legacy.
We hope you enjoy this selection of articles from EL PAÍS USA Edition
Dear readers,
Dominique Pélicot and 50 other men have been found guilty in what is perhaps one of the most high-profile, shocking, and globalized trials of the last decade. We go over the keys to a case that leaves nobody indifferent.
This week we also bring you a one-on-one interview with Marine Le Pen, the leader of France's far-right National Rally, as she faces a make-or-break moment that could soon lead her to the Élysée, or to prison.
EL PAÍS also interviewed the American philosopher Judith Butler and the actor Jude Law. Other featured stories this week include an analysis of the group leading change in Syria, a look at Madrileños who can't afford rent and live in capsules, and a look back at Playgirl magazine's legacy.
We hope you enjoy this selection of articles from EL PAÍS USA Edition
You can also read:
- 2024: A bleak year for hunger and poverty, with an unexpected ray of hope
- Meet the Madrileños who move into Toyko-style capsules when they can’t pay their rent
- Claudia Goldin, 2023 Nobel Prize winner in Economics: ‘Feminism became a very bad word in the United States’
- Travel ideas: A holiday home to relax like a hobbit
- Vintage ‘jamón,’ the foodie luxury fetching up to €80,000
- We haven’t seen you in a while’: Duolingo’s passive-aggressive strategy for keeping users hooked
Saturday, 21 December 2024
Catch up with / on your English!!!
- Try to find a few minutes a day to catch up on those aspects of your learning you feel weaker at.
- Or devote more time to that specific topic / field you want to know more about...
- Or just re-read that post / note you weren't able to find time for earlier in the year.
- Buy an English magazine / Find a website dealing with a topic you're interested in or get a novel you feel like reading or re-reading (in English).
- Download the lyrics of your favourite songs (and sing along!)- Listen to the English news (BBC or SkyNews ...)
Do post comments with other suggestions you might find useful to review and share them with your mates!!!
Friday, 20 December 2024
Christmas Traditions (from Dictionary.com)
From Carols To Cookies: The Stories Behind 12 Of Your Favorite Christmas Traditions
Christmastime is rife with traditions—lights, carols, presents, and more! Let's look at the most popular and beloved traditions to learn about their origins.
Deck the halls with this Christmas Traditions Quiz
Christmastime is rife with traditions—lights, carols, presents, and more! Let's look at the most popular and beloved traditions to learn about their origins.
Deck the halls with this Christmas Traditions Quiz
Thursday, 19 December 2024
C1 & C2 Christmas Quiz
Christmas Quiz. It'll be very easy for you to do if you attended our Language Assistants' Talks!
You need 13 out of 20 to pass!
Answers next week
Today's Program
I'll be giving the Talk Christmas Jokes (the same as last year) from 16.00 to 17.00 and 20.00 to 21:00.
Wednesday, 18 December 2024
Tuesday, 17 December 2024
Monday, 16 December 2024
News in English EL PAÍS
‘We got rid of one problem and woke up with another’
Dear readers,
The fall of Bashar al-Assad last Sunday following a lightning offensive by rebel groups sparked scenes of joy throughout Syria as a protracted civil war and more than half a century of iron-clad dictatorship came to an end. The country now looks to the future with a transitional government in place that aims to draft a new Constitution within six months. However, the path to democracy remains fraught with obstacles. Not only will the fundamentalist militia Hay’at Tahrir al-Sham, which led the offensive against the regime, need to accommodated, Israel has already taken advantage of the power vacuum to stage a military operation on Syrian soil for the first time since the 1973 Yom Kippur War, with the aim of preventing the incoming authorities from using military capabilities against the Jewish State, and the rearming of Hezbollah.
We interviewed Ukrainian Finance Minister Sergii Marchenko, who discussed the evolution of relations with Washington when the Donald Trump administration takes the reins and the current situation on the battlefield, as well as Ukraine's accession to NATO. "We already have the Budapest Memorandum and it did not serve any purpose in terms of Ukraine’s security. That’s why there should be very clear security guarantees for Ukraine. And right now I can’t imagine these guarantees without NATO," he told EL PAÍS.
Elsewhere, we looked at how the nomination of Elon Musk devotee Jared Isaacman as NASA administrator could affect the U.S. space agency and the possibility of future missions to Mars, examined how Chevy Chase became one of America's most beloved comedy icons despite an abrasive personality that led one observer to note "not everyone hates Chevy Chase. Just the people who have worked with him," and took a trip to the “World Capital of the UFO Phenomenon,” La Rumorosa in Mexico, to see if the truth is out there.
We hope you enjoy this selection of stories from EL PAÍS USA Edition.
Dear readers,
The fall of Bashar al-Assad last Sunday following a lightning offensive by rebel groups sparked scenes of joy throughout Syria as a protracted civil war and more than half a century of iron-clad dictatorship came to an end. The country now looks to the future with a transitional government in place that aims to draft a new Constitution within six months. However, the path to democracy remains fraught with obstacles. Not only will the fundamentalist militia Hay’at Tahrir al-Sham, which led the offensive against the regime, need to accommodated, Israel has already taken advantage of the power vacuum to stage a military operation on Syrian soil for the first time since the 1973 Yom Kippur War, with the aim of preventing the incoming authorities from using military capabilities against the Jewish State, and the rearming of Hezbollah.
We interviewed Ukrainian Finance Minister Sergii Marchenko, who discussed the evolution of relations with Washington when the Donald Trump administration takes the reins and the current situation on the battlefield, as well as Ukraine's accession to NATO. "We already have the Budapest Memorandum and it did not serve any purpose in terms of Ukraine’s security. That’s why there should be very clear security guarantees for Ukraine. And right now I can’t imagine these guarantees without NATO," he told EL PAÍS.
Elsewhere, we looked at how the nomination of Elon Musk devotee Jared Isaacman as NASA administrator could affect the U.S. space agency and the possibility of future missions to Mars, examined how Chevy Chase became one of America's most beloved comedy icons despite an abrasive personality that led one observer to note "not everyone hates Chevy Chase. Just the people who have worked with him," and took a trip to the “World Capital of the UFO Phenomenon,” La Rumorosa in Mexico, to see if the truth is out there.
We hope you enjoy this selection of stories from EL PAÍS USA Edition.
You can also read:
- Spain to prepare its first inventory of sites affected by radioactive contamination
- Enemies, aliens, prototypes?: Mysterious drone sightings in New Jersey raise alarm
- Travel ideas: A holiday home to relax like a hobbit
- 40 years of cyberpunk: A dystopian future that seems all too real today
- ‘Instagram therapy’ offers self-diagnoses, vocabulary and justifications, but it does not solve anything
Saturday, 14 December 2024
TALKS AND GAMES for next week
Tuesday 17
Talk by Tim at 6:00 p.m. Assembly Hall
Wednesday 18
Talk by Harriet & Lauryna at 17:00-18:00 and 19:00-20:00 Assembly Hall
Thursday morning
Isa & Harriet 10:30 "Guess the Ad" Room 12
Thursday afternoon
Lauryna 17:00-18:00 and 19:00 - 20:00 Assembly Hall
CAROLS AND KARAOKE
Friday, 13 December 2024
Word Formation (online exercises & hundreds of words with affixes)
Do some of the activities with ADVANCED labels. Check your score and improve it little by little. Revise most common affixes here and check hundreds of them here (keep the list as reference material).
Thursday, 12 December 2024
Wednesday, 11 December 2024
Tuesday, 10 December 2024
Laugh, Smile, ha ha ha!
Monday, 9 December 2024
News in English ELPAÍS
Tensions escalate on US border
Dear readers,
Armed civilian groups that patrol the U.S.-Mexico border in search of illegal migrants are hopeful that they will be asked to officially cooperate with Donald Trump's immigration agenda. The news comes as migrant caravans continue to make their way to the United States, despite the president-elect's deportation threats.
We also spoke to former German chancellor, Angela Merkel, about her time in power, her life in the GDR and her legacy; traveled to Pervomaisk, the last Ukrainian city to host nuclear weapons; and took a deep dive into NRx, the neo-reactionary movement that believes that democracy is a mistake.
And in lighter news, we looked at Taylor Sheridan, the cowboy-turned-director behind the success of hit TV shows such as 'Yellowstone.'
We hope you enjoy this selection of stories from EL PAÍS USA Edition.
You can also read:
Dear readers,
Armed civilian groups that patrol the U.S.-Mexico border in search of illegal migrants are hopeful that they will be asked to officially cooperate with Donald Trump's immigration agenda. The news comes as migrant caravans continue to make their way to the United States, despite the president-elect's deportation threats.
We also spoke to former German chancellor, Angela Merkel, about her time in power, her life in the GDR and her legacy; traveled to Pervomaisk, the last Ukrainian city to host nuclear weapons; and took a deep dive into NRx, the neo-reactionary movement that believes that democracy is a mistake.
And in lighter news, we looked at Taylor Sheridan, the cowboy-turned-director behind the success of hit TV shows such as 'Yellowstone.'
We hope you enjoy this selection of stories from EL PAÍS USA Edition.
You can also read:
- Ben Feringa, Nobel Prize in Chemistry: ‘A single cell is more complex than an entire city’
- Miami Art Week 2024: The Latino artists to watch
- Journey to La Rumorosa, Mexico’s UFO town
- AI to slash music and audiovisual industry revenues by over 20% by 2028, report warns
- The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
Saturday, 7 December 2024
Friday, 6 December 2024
C1 Written Mediation Activity
this document on his email. He has asked you for some advice on what to read during Christmas. Tim enjoys fiction novels taking place in the USA and hates remakes. Which two novels would you recommend him? Write to Tim 125-150 words, giving your advice and reasons.
Prepare the task for next Tuesday.
Exam Practice
You can find a high number of final exams from several Comunidades on this page. Go to Nivel Avanzado C1 & C2. Do them keeping to the given times and remember that CARM C1 and C2 exams are not exactly the same as those of other EOIs in Spain.
Good Luck!
Thursday, 5 December 2024
Wednesday, 4 December 2024
C2 Writing Statistical Reports
Have a look at this document and do the suggested activities. Check too:
· Impersonal Report Structures
· Report Phrase Sheet












































